I am working on a Perl script to search within a string of nucleotides for patterns. So far, I've been able to use the following regexs
my $regex1 = qr/( ([ACGT]{2}) \2{9,} )/x;
my $regex2 = qr/( ([ACGT]{3}) \2{6,} )/x;
my $regex3 = qr/( ([ACGT]{4}) \2{6,} )/x;
for my $regex ($regex1, $regex2, $regex3) {
next unless $seq1 =~ $regex;
printf "Matched %s exactly %d times\n", $2, length($1)/length($2);
printf "Length of sequence: $number \n";
}
How would I go about doing the following?
-finding perfect (repeated with no interruption) and imperfect (repeated but can have string of repeats broken by a nucleotide) with a minimum of 10 repeats needed.
-print the entire found sequence
SAMPLE INPUT - GTCGTGTGTGTGTAGTGTGTGTGTGTGAACTGA
Current script in its entirety
print "Di-, Tri-, Tetra-nucleotide Tandem Repeat Finder v1.0 \n\n";
print "Please specify the file location (DO NOT DRAG/DROP files!) then press ENTER:\n";
$seq = <STDIN>;
#Remove the newline from the filename
chomp $seq;
#open the file or exit
open (SEQFILE, $seq) or die "Can't open '$seq': $!";
#read the dna sequence from the file and store it into the array variable @seq1
@seq1 = <SEQFILE>;
#Close the file
close SEQFILE;
#Put the sequence into a single string as it is easier to search for the motif
$seq1 = join( '', @seq1);
#Remove whitespace
$seq1 =~s/\s//g;
#Count of number of nucleotides
#Initialize the variable
$number = 0;
$number = length $seq1;
#Use regex to say "Find 3 nucelotides and match at least 6 times
# qr(quotes and compiles)/( ([nucs]{number of nucs in pattern}) \2{number of repeats,}/x(permit within pattern)
my $regex1 = qr/( ([ACGT]{2}) \2{9,} )/x;
my $regex2 = qr/( ([ACGT]{3}) \2{6,} )/x;
my $regex3 = qr/( ([ACGT]{4}) \2{6,} )/x;
#Tell program to use $regex on variable that holds the file
for my $regex ($regex1, $regex2, $regex3) {
next unless $seq1 =~ $regex;
printf "Matched %s exactly %d times\n", $2, length($1)/length($2);
printf "Length of sequence: $number \n";
}
exit;