I have an RNA string on text format file. I want to import/read it from the txt file for translate function of Biostrings package in R.
I tried readRNAStringSet before but this function reads FASTA and FASTQ formats, however, my file is not FASTA or FASTQ but it's txt and I wanna read from that one.
In my file, there's no quotation mark but after the last code, there's space. Eventually, When I read this RNA string, I want to translate it to its protein amino acids using "translate" function in Biostrings package.
As an example, I have the RNA string bellow in "txt" file, there's no quotations and no other sign in the file and there's only one string:
AUGCCGGUAAAGCGUGUCACAGAACUCCAUUUACUAUUAUGCCUUUGUGCGGGAGGAAGUUUCAGAAAGUACAUUCAUCCUGGA