Biopython: url open error for qblast

Question

I am trying a basic Biopython example from an online course. However, I am unable to query the NCBIWWW database to align a query sequence. The program fails with a URL error.

My code is as follows:

from Bio.Blast import NCBIWWW, NCBIXML

fasta_string = "TGGGCCTCATATTTATCCTATATACCATGTTCGTATGGTGGCGCGATGTTCTACGTGAATCCACGTTCGAAGGACATCATACCAAAGTCGTACAATTAGGACCTCGATATGGTTTTATTCTGTTTATCGTATCGGAGGTTATGTTCTTTTTTGCTCTTTTTCGGGCTTCTTCTCATTCTTCTTTGGCACCTACGGTAGAG"

h = NCBIWWW.qblast("blastn", "nt", fasta_string)

However, this returns the following error:

urllib2.URLError: <urlopen error [Errno 8] nodename nor servname provided, or not known>

Do I need to configure Biopython before I use it? I think I am using the correct parameters to the blast function.

it works fine for me ...... do server connection have **proxy** ? — Jose Ricardo Bustos M., Oct 06 '15 at 19:12
hmmmmm... what do you mean by "proxy server connection have proxy"? I'm afraid, I do not quite follow. — Luca, Oct 06 '15 at 19:14
may be, you must add proxy configuration [using-an-http-proxy-python](http://stackoverflow.com/questions/5620263/using-an-http-proxy-python) .... — Jose Ricardo Bustos M., Oct 06 '15 at 19:20
`import urllib2; urllib2.urlopen("http://www.google.com").read()` is It working ? — Jose Ricardo Bustos M., Oct 06 '15 at 19:23
ok It isn't proxy problem, do you made many requests to NCBI ? ..... they deny service after many many many requests — Jose Ricardo Bustos M., Oct 06 '15 at 19:31
No, it was the first time I tried it today as I just learnt about Biopython. It also does not say anything about connection timing out.... just the error message that I posted... The thing is now I tried the same code from my university machine and it worked... — Luca, Oct 06 '15 at 19:33

Biopython: url open error for qblast

0 Answers0