Python 2 and Python 3 different behavior on floating point?

Question

Hi consider this code below:

DNA = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
lenght_DNA = len(DNA)
print ("lenght:" + str(lenght_DNA))
a_count = DNA.count('A')
print ("A-count:" + str(a_count))
t_count = DNA.count('T')
print ("T-count:" + str(t_count))
AT_content = (a_count + t_count)/(lenght_DNA)
print ("AT_content:" + str(AT_content))

In Python 2 the final print gives 0 in python 3 a correct decimal number like 0.63blabla. How do i get the same behavior in Python 2?

http://stackoverflow.com/questions/1282945/python-integer-division-yields-float — Abdou, Sep 05 '16 at 11:48
@TigerhawkT3 If you choose to mark as duplicate and downvote all answers, at least choose the right duplicate. — code_onkel, Sep 05 '16 at 12:54

score 3 · Accepted Answer · answered Sep 05 '16 at 11:50

The division operator in Python 2 on two integer arguments, which your lengths are, will do integer division. In integer division the fractional part is discarded. In Python 3 this was changed to do floating point division.

There are two solutions:

The first is to cast the arguments to a float:

AT_content = float(a_count + t_count)/(lenght_DNA)

the second is to change the division behaviour to the Python 3 behaviour at the top of your script:

from __future__ import division

score 1 · Answer 2 · edited Sep 27 '17 at 04:18

1

How do i get the same behavior in Python 2?

I would look here for that - however it's much easier (and highly recommended) to learn more broadly the 2v3 differences and understand the process rather than be told this one piece of information

edited Sep 27 '17 at 04:18

Graham

7,431
18
59
84

answered Sep 05 '16 at 11:49

Scott Stainton

394
2
14

ferdy · Answer 3 · 2016-09-05T12:00:02.687

You either have to define the operand as an integer value in form of this or you need to explicitly cast any operand to float:

In [1]: 2/3
Out[1]: 0

In [2]: float(2)/3
Out[2]: 0.6666666666666666

In [3]: 2/float(3)
Out[3]: 0.6666666666666666

In [5]: 2.0/3
Out[5]: 0.6666666666666666

In [6]: 2/3.0
Out[6]: 0.6666666666666666

Another way, which also gives you control over precision, rounding and others is the application of decimal package. It also gives you the same approach in either Python 2 or 3:

In [7]: from decimal import *

In [8]: Decimal(2)/Decimal(3)
Out[8]: Decimal('0.6666666666666666666666666667')

Read more here: https://docs.python.org/2/library/decimal.html

Third approach would be to import the python 3 floating point division handling from __future__ like this:

In [9]: from __future__ import division

In [10]: 2/3
Out[10]: 0.6666666666666666

Python 2 and Python 3 different behavior on floating point?

3 Answers3