-1

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG."

Given: A DNA string s

of length at most 1000 nt.

Return: Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21

can someone help me figure this code for python 3 on a mac? I am sorry I am totally not accustomed with python

Willem Van Onsem
  • 443,496
  • 30
  • 428
  • 555
Danielle Glogovsky
  • 1
  • 1
  • 1

1 Answers1

1

Pretty easy.

from collections import Counter
s = 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
a = Counter(s)
print (a)

Counter({'T': 21, 'A': 20, 'G': 17, 'C': 12})

ashish trehan
  • 413
  • 1
  • 5
  • 9
  • First, `[*s]` is totally unecessary, *`str` objects are iterable directly*. Second, this is clearly a duplicate, please vote to close as duplicate rather than answering. – juanpa.arrivillaga Oct 18 '17 at 18:33