Reading a specific part of a text file as a string in C?

Question

I'm writing code that reads huge text files containing DNA bases and I need to be able to extract specific parts. The file looks like this:

TGTTCCAGGCTGTCAGATGCTAACCTGGGG
TCACTGGGGGTGTGCGTGCTGCTCCAGCCT
GTTCCAGGATATCAGATGCTCACCTGGGGG

...

Every line is 30 characters.

I have a separate file indicating these parts, meaning I have a start value and an end value. So for each start and end value, I need to extract the corresponding string in the file. For example, if I have start=10, end=45, I need to store the string which starts at the 10th character of the first line (C) and ends at the 15th character of the 2nd line (C) in a separate temporary file.

I tried using the fread function as seen below for a test file with the above lines of letters. The parameters were start=1, end=90 and the resulting file looks like this:

TGTTCCAGGCTGTCAGATGCTAACCTGGGG
TCACTGGGGGTGTGCGTGCTGCTCCAGCCT
GTTCCAGGATATCAGATGCTCACCTGGG™eRV

Each run will give random characters at the end.

The code:

FILE* fp;
fp=fopen(filename, "r");
if (fp==NULL) puts("Failed to open file");

int start=1, end=90;
char string[end-start+2]; //characters from start to end = end-start+1

fseek(fp, start-1, SEEK_SET);

fread(exon,1, end-start+1, fp);

FILE* tp;
tp=fopen("exon", "w");
if (tp==NULL) puts("Failed to make tmp file");

fprintf(tp, "%s\n", string);
fclose(tp);

I couldn't understand how fread handles \n characters so I tried replacing it with the following:

int i=0;
char ch;
while (!feof(fp))
{
            ch=fgetc(fp);

            if (ch != '\n') 
            {
                string[i]=ch;
                i++;
                if (i==end-start) break;
            }

}
string[end-start+1]='\0';

It created the following file: TGTTCCAGGCTGTCAGATGCTAACCTGGGGTCACTGGGGGTGTGCGTGCTGCTCCAGCCTGTTCCAGGATATCAGATGCTCACCTGGGGô

(without any line breaks, which I don't mind). Again with each run, I get a different random character instead of 'G'.

What am I doing wrong? Is there a way to get it done with fread or some other function?

Thank you in advance.

Answer 1

I have modified your code and added comments to it for explanation.

Please go through it. You have neglected the error checking, code has few undefined variables.

I have returned from the if block on failure, goto` would be more appropriate.

Please refer this comment for whether to add 1 char or 2 chars to start and end.

#include <stdio.h>
#include <string.h>
#include <stdlib.h>

int main()
{
        FILE* fp;
        // fp = fopen(filename, "r");
        // since the filename is undeclared i have used hard coded file name
        fp = fopen("dna.txt", "r");
        // Nothing wrong in performing error checking
        if (fp == NULL) {
                puts("Failed to open file");
                return -1; 
        }

        // Make sure start is not 0 if you want to use indices starting from 1
        int start = 1, end = 90; 

        // I would adjust the start and end index by adding count of '\n' or '\r\n' to the start and end
        // Here I am adjusting for '\n' i.e 1 char
        // since you have 30 chars so hardcoding it.
        int m = 1; // m depends on whether it is \n or \r\n
                   // 1 for \n and 2 for \r\n
        --start; --end; // adjusting indexes to be 0 based
        if (start != 0)
                start = start + (start / 30) * m;   // start will be 0
        if (end != 0)
                end = end + (end / 30) * m;         // start will be 93

        // lets declare the chars to read
        int char_to_read = end - start + 1;

        // need only 1 extra char to append null char
        // If start and end is going to change, then i would suggest using malloc instead of static buffer
        // because compiler cannot predict the memory to allocate to the buffer if it is dependent on external factor
        // char string[char_to_read + 1]; //characters from start to end = end-start+1

        char *string = malloc(char_to_read + 1); 
        if (string == NULL) {
                printf("malloc failed\n");
                fclose(fp);
                return -2;
        }

        // zero the buffer
        memset(string, 0, char_to_read + 1); 

        int rc = fseek(fp, start, SEEK_SET);
        if (rc == -1) {
                printf("fseek failed");
                fclose(fp);
                return -1;
        }

        // exon is not defined, and btw we wanted to read in string.
        int bytes_read = fread(string, 1, char_to_read, fp);

        // Lets check if there is any error after reading
        if (bytes_read == -1) {
                fclose(fp);
                return -1; 
        }

        // Now append the null char to the end
        string[bytes_read] = 0;
        printf("%s\n", string);
        fclose(fp);

        // free the memory once you are done with it
        if (string)
                free(string);


// Now u can write it back to file.
//      FILE* tp;
//      tp=fopen("exon", "w");
//      if (tp==NULL) puts("Failed to make tmp file");

//      fprintf(tp, "%s\n", string);
//      fclose(tp);
}