-3

I'm a beginner in Python and I'm trying to write an IF statement with multiple OR conditions in the expression. My problem is that the expression is only "True" for the first OR condition.

def rna_length(mrna): if (mrna[-3:]) == ("UGA" or "UAA" or "UAG"): return print("TRUE!") else: return print("False")

rna_length('AUGAGGCACCUUCUGCUCCUUAA')

I was expecting True after running the code but the code is printing False. Kindly help me understand my mistake.

JohnDoe
  • 1

1 Answers1

1

Here is how to do:

if mrna[-3:] in ("UGA", "UAA", "UAG"):

("UGA" or "UAA" or "UAG") will return "UGA" because the operator or return the first non-False value. Since non-empty strings arn't False the first value is returned.

Cubix48
  • 2,607
  • 2
  • 5
  • 17