Stack Overflow
Stack Overflow

Questions tagged [xul]

XUL is an XML-based user interface markup language developed by Mozilla. It allows creating native-looking applications and is the base of Mozilla products like Firefox and Thunderbird as well as applications based on the Mozilla XULRunner platform.

XUL (XML User Interface Language) is a markup language developed by Mozilla. It allows creating native-looking application user interfaces and integrates with web technologies like JavaScript and CSS. It is a cornerstone of Mozilla products like Firefox and Thunderbird as well as applications based on the Mozilla XULRunner platform.

The primary source of XUL documentation is the Mozilla Developer Network, with the XUL tutorial being particularly recommendable when learning XUL.

Useful links

1334 questions
234
votes
16 answers

How can I force a long string without any blank to be wrapped?

I have a long string (a DNA sequence). It does not contain any whitespace character. For example: ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA What would be the CSS selector to force this text…
Pierre
  • 34,472
  • 31
  • 113
  • 192
98
votes
8 answers

.setAttribute("disabled", false); changes editable attribute to false

I want to have textboxes related to radiobuttons. Therefore each radio button should enable it's textbox and disable the others. However when I set the disabled attribute of textbox to true, it changes the editable attribute too. I tried setting…
Ghokun
  • 3,345
  • 3
  • 26
  • 30
36
votes
2 answers

Accessing Google Drive from a Firefox extension

I'm trying to access (CRUD) Google Drive from a Firefox extension. Extensions are coded in Javascript, but neither of the two existing javascript SDKs seem to fit; the client-side SDK expects "window" to be available, which isn't the case in…
retorquere
  • 1,496
  • 1
  • 14
  • 27
30
votes
4 answers

What does 'chrome' mean?

content: A browser for content. The content that is loaded inside the browser is not allowed to access the chrome above it. This sentence is seen on the Mozilla documentation for XUL. What does the word chrome mean in this context?
C--
  • 16,393
  • 6
  • 53
  • 60
23
votes
8 answers

Get current page URL from a firefox sidebar extension

I'm writing a sidebar extension for Firefox and need a way to get the URL of the current page so I can check it against a database and display the results. How can I do this?
Hintswen
  • 3,987
  • 12
  • 40
  • 45
19
votes
7 answers

How To Create a Quick Minimal Firefox Extension?

What the minimum basic setup required to begin developing a Firefox extension?
Balaji Sowmyanarayanan
  • 872
  • 1
  • 8
  • 15
18
votes
3 answers

getBoundingClientRect() is returning zero in XUL

I have a problem with my firefox extension I have a XUL popup panel with a hbox for the tag cloud, and a JS code to add divs to this hbox: JS: var root = document.getElementById('tag_base'); var tag…
Andrei Sch.
  • 381
  • 1
  • 3
  • 10
14
votes
7 answers

Is anyone using a firefox XUL IDE?

I'm not interested in Firebug, a XUL debugger, or a JavaScript editor, but a true WYSIWYG IDE for XUL form design.
Noah
  • 15,080
  • 13
  • 104
  • 148
14
votes
2 answers

Firefox plugin to click button download a file and post it to another server

I have access a website that has a simple button (I dont own the site and dont have access to the source) to download a document. I am using the code below to execute this and it seems to work ok but is glitchy Objective I want to download the…
user1320651
  • 808
  • 2
  • 15
  • 42
13
votes
4 answers

Opening a URL in current tab/window from a Firefox Extension

I am creating a Firefox Extension...what would be the javascript to open a URL in the current tab from a menuitem? e.g. in my overlay.xul file i have the following line:
aryo
  • 695
  • 2
  • 7
  • 13
12
votes
6 answers

Firefox extensions & XUL: get page source code

I am developing my first Firefox extension and for that I need to get the complete source code of the current page. How can I do that with XUL?
Franz
  • 11,353
  • 8
  • 48
  • 70
12
votes
5 answers

WYSIWYG Editor for XUL

Can anybody recommend a good graphic WYSIWYG editor for XUL?
Kenn
  • 2,379
  • 2
  • 29
  • 38
11
votes
2 answers

Replicating Google Chrome Browser Actions popup Effect in a Firefox Extension

Chrome Browser Actions provide a really nice popup effect by default. dead ImageShack image link removed Hovering over the toolbar icon provides a neat hover effect. Clicking the toolbar icon shows a nice animation that opens the popup html…
CPrimer
  • 623
  • 1
  • 6
  • 13
11
votes
1 answer

CSS pointer-events='none' and/or XUL mousethrough='always' in web pages for Firefox

Very recently I asked this question on how to pass clicks through an element (e.g. full screen overlaying ). Received some good advice, but I still wondered which browsers supported this natively... For those skipping the previous link, the overlay…
LeslieOA
  • 610
  • 2
  • 8
  • 18
10
votes
3 answers

Using Add-on SDK to add toolbar buttons? Integrating XUL and Add-on SDK for Firefox Add-ons?

I have already coded most of a Firefox add-on using the Add-on SDK API. I am now discovering that Add-on SDK might not be powerful enough for my purposes. I need two things: A drop down button in the toolbar next to the location bar. To modify the…
Salami
  • 2,849
  • 4
  • 24
  • 33
1
2 3
…
88 89